Apparently BLAST doesn't like it when there are spaces between fasta entries (at least this is what my experience has been). When working with large fasta files, no one wants to remove the blank lines by hand. Here is a fast way to remove the blank lines in a fasta file in terminal:

cat sequences.fasta | sed /^$/d > sequences_no_blanks.fasta

This will turn:

>sequenceA
ATGCACACGATGATCGATCCGCGGCATCAGCAGCCTACGAGCAGCAGCGACGACGAGCAGCTACGAAGATATAGAGCA

>sequenceB
GTGTGTGTACAGCTGACTCGCGCGCGCGCGCAAGATATATAGAAGTAATATAGA

Into this:

>sequenceA
ATGCACACGATGATCGATCCGCGGCATCAGCAGCCTACGAGCAGCAGCGACGACGAGCAGCTACGAAGATATAGAGCA
>sequenceB
GTGTGTGTACAGCTGACTCGCGCGCGCGCGCAAGATATATAGAAGTAATATAGA